Sanger’s chain termination gene sequencing- Explained
Suppose we have to do the sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion using Sanger’s sequencing. Steps of DNA sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion: DNA Sequence 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ (The yellow portion is unknown and to know it, we do sequencing. This sequence in yellow is shown for reference)…