Sanger’s chain termination gene sequencing- Explained
|

Sanger’s chain termination gene sequencing- Explained

Suppose we have to do the sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion using Sanger’s sequencing. Steps of DNA sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion: DNA Sequence 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ (The yellow portion is unknown and to know it, we do sequencing. This sequence in yellow is shown for reference)…

The science behind Ostrich People
| | | |

The science behind Ostrich People

What comes to your mind when you hear ostrich people? Well! they don’t look like an ostrich. They are called so by some people as their feet appear, somewhat like- an ostrich feet. These are vaDoma people also known as Bantwana tribe (Bantwana means “descendants”) Doma or dema who live generally in Sipolilo and Urungwe districts of the Kanyemba region in Northern…

Dog’s loyalty to Humans- Scientifically Explained
| |

Dog’s loyalty to Humans- Scientifically Explained

Oh! the Man’s Best Friend and those cute, lovely, and loyal pets. Ever wondered why Dogs are loyal? Is there any science behind it? In this article, we will try to explain it with scientific facts and hypotheses. We will describe these in this article. Dogs were first thought to have descended from wolves and according…

|

India sets record for 10 Lakhs tests per day of Covid-19

Covid-19 has been infecting people across the globe. However, its spread has slowed down in most of the countries. Globally, as of 12:48 pm CEST on 23rd August 2020, 23,057,288 confirmed cases of Covid-19, including 800,906 deaths has been reported to WHO. According to press release on 22nd August by ICMR (Indian Council of Medical Research), India crosses 10+ Lakhs mark for testing of Covid-19 in 24 hours. India has conducted 10, 23, 836 sample…

Russia’s Sputnik V- World’s First Covid-19 Vaccine- Explained
|

Russia’s Sputnik V- World’s First Covid-19 Vaccine- Explained

Key Points Russian President Vladimir Putin on 11th August announced the registration of World’s first Covid-19 vaccine, as claimed by Russia. Clinical trials are yet to be completed, despite the fact that the vaccine is already registered. Phase III clinical trials will begin on Wednesday. Putin stated one of his daughters had been vaccinated with it. This vaccine candidate by…

Zydus’s Vaccine for Covid-19 enters Phase II
| |

Zydus’s Vaccine for Covid-19 enters Phase II

India’s pharmaceutical company Zydus Cadila’s Vaccine candidate for Covid-19 named ‘ZyCoV-D’ claimed to have completed Phase I of clinical trials. According to a press release on its website dated on 5th August 2020, the company said to enter Phase II clinical trials from 6th August 2020.  The Phase I of this vaccine candidate began on 15th July 2020 and was administered to healthy…

| | | | |

Herd immunity and Covid-19 Explained

What is Herd Immunity? Herd immunity is a form of indirect protection from an infectious disease, providing a measure of protection to non-immunized individuals in a population, mainly as a result of a large fraction of the population being immune to a particular disease whether through vaccination or recovery from the infection. Herd immunity is also called as…

| |

Participate in NASA’s Perseverance Launch Online

NASA, for its next mission to red planet- the Mars 2020, will send the rover named Perseverance to the Mars. NASA is inviting people to participate in the virtual event. Anyone can participate in this online event. Participation is free! The event is scheduled at Thursday, July 30 2020, 7:50 AM EDT from Cape Canaveral Air Force Station, Florida.   According to…

Russia’s Covid-19 vaccine, The truth?
| |

Russia’s Covid-19 vaccine, The truth?

Some media channels on Sunday (12th July) reported that Russia’s Sechenov University had completed clinical trials of a vaccine for the novel coronavirus (SARS-CoV-2), claiming it as the ‘first vaccine in the world to complete human trials for Covid-19.’ We are here to tell you that it’s not true and they misstated it. Sputnik News was one of the media channels…

Zydus’s ZyCov-D | Covid-19 Vaccine candidate Explained
| |

Zydus’s ZyCov-D | Covid-19 Vaccine candidate Explained

Covid-19 is still spreading at an unprecedented rate. Scientists all around the world are working day and night to develop a vaccine for it. The vaccine candidate was found to be safe and immunogenic in clinical trials.  Antibodies produced after injection was able to completely neutralize the virus. ZyCoV-D uses a non-replicative and non-integrative plasmid….