Sanger’s chain termination gene sequencing- Explained
|

Sanger’s chain termination gene sequencing- Explained

Suppose we have to do the sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion using Sanger’s sequencing. Steps of DNA sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion: DNA Sequence 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ (The yellow portion is unknown and to know it, we do sequencing. This sequence in yellow is shown for reference)…

| | | | |

Herd immunity and Covid-19 Explained

What is Herd Immunity? Herd immunity is a form of indirect protection from an infectious disease, providing a measure of protection to non-immunized individuals in a population, mainly as a result of a large fraction of the population being immune to a particular disease whether through vaccination or recovery from the infection. Herd immunity is also called as…