|

Sanger’s chain termination gene sequencing- Explained

Suppose we have to do the sequencing of 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion using Sanger’s sequencing.

Steps of DNA sequencing of 
5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ using primer against underlined portion:

DNA Sequence 5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ (The yellow portion is unknown and to know it, we do sequencing. This sequence in yellow is shown for reference)

                           ↓

Add 5’ ACGACGATC 3‘ Primer

                           ↓

5’ CCTAGTCGATCGTCTCGATCGTCGT 3’ DNA sequence

3’ CTAGCAGCA 5’ Primer complementary to a small stretch of DNA.

                           ↓

sanger sequencing example

Start reading from the bottom: 5’GAGACGATCGACTAGG 3’, and to get the original sequence reverse and complement the sequence: 5’CCTAGTCGATCGTCTC 3’.

The obtained sequence in this process: 5’CCTAGTCGATCGTCTC 3’

Basis of chain termination method of sequencing:

Dideoxynucleotides or the ddNTPs are the artificially synthesized modified nucleotides used in the Sanger sequencing technique. The ddNTPs are different from the normal dNTPs as they don’t have the hydroxyl group (-OH) at the 3′-C as well as the 2′-C of the deoxyribose sugar. 

The 3’ OH end of the deoxynucleotides facilitates DNA synthesis by Taq DNA polymerase while due to the lack of -OH at the 3’ end, the polymerase (Klenow segment/fragment in this case) can’t elongate the DNA chain when it encounters the ddNTPs. 

Although the 5′-C can form a phosphodiester bond with the previous nucleotide in the chain, the 3′-C cannot form a bond with the next incoming dNTP. The addition of a ddNTP during DNA replication, therefore, stops synthesis.

Once the analog is incorporated at the growing point of the DNA chain, the 3′ end lacks a hydroxyl group and no longer is a substrate for chain elongation. Thus,
the growing DNA chain is terminated, i.e.
dideoxynucleotides act as chain terminators
.

As these ddNTPs are radiolabelled, they can be detected using
radiographic techniques.

PROCESS OF CHAIN –TERMINATION METHOD OF SEQUENCING:

1. A sample of DNA is taken and made single-stranded (used as template strand).

2. These samples of single-stranded DNA are divided into 4 different test tubes.

3. The template is attached to the primer (a short length of DNA, oligonucleotides), which is complementary to the small section of the template

4. The 3’-OH group of primer initiates the DNA synthesis.

5. Each tube contains primer-DNA, Klenow segment (larger fragment of DNAthe polymerase of E. coli having polymerization activity but lacking 5’ → 3’ exonuclease activity), dNTPs, modified nucleotides ie; ddNTPs which is radiolabelled (mostly) or labeled with fluorescent dyes.

Two properties of DNA polymerases are utilized:

(i) their ability to synthesize a complimentary copy of a single-stranded DNA template; and (ii) their ability to use 2’, 3dideoxynucleotides as substrates.

6. Synthesis of DNA in each tube takes place, which contains fragments of DNA of variable length. 

7. The sample (fragment of DNA) from each tube is separated by polyacrylamide gel electrophoresis (PAGE).

8. The sequence of bases in a DNA fragment is determined by the electrophoretic bands (radiolabelled mostly) by autoradiography.

 


  • Bitcoin
  • Ethereum
  • Tether
  • Cardano
  • Polkadot
  • Binance coin
  • Litecoin
  • Dogecoin
  • Tron
  • Vechain
Scan to Donate Bitcoin to 1GxMAL3wwoB7z6nSTBB38hEKMXAjHifNnD

Donate Bitcoin to this address

Scan the QR code or copy the address below into your wallet to send some Bitcoin

Tag/Note:- BTC Network for Bitcoin. Send only BTC to this deposit address. Ensure the network is BTC.
Scan to Donate Ethereum to 0xd9102c12bb34df9b59425dec6b81c3007f8266dd

Donate Ethereum to this address

Scan the QR code or copy the address below into your wallet to send some Ethereum

Tag/Note:- ERC20 Ethereum (ETH) Address. Send only ETH to this deposit address. Ensure the network is ERC20.
Scan to Donate Tether to TXAyU5qeuiHoDYBFXSkisrfKRBWaVDN3u6

Donate Tether to this address

Scan the QR code or copy the address below into your wallet to send some Tether

Tag/Note:- TRC20 Tron (TRX) Address. Send only USDT to this deposit address. Ensure the network is TRC20.
Scan to Donate Cardano to DdzFFzCqrhsdycuk395N4fAN9YwEbb37Vw11fhb5u8aMzAgMJbdw9CfxugF2ufjC7qaSpoPVvwXsj5MDMvTecpRskpyNVgo8ecg4XyJz

Donate Cardano to this address

Scan the QR code or copy the address below into your wallet to send some Cardano

Tag/Note:- Cardano Network for ADA. Send only ADA to this deposit address. Ensure the network is Cardano.
Scan to Donate Polkadot to 14628awZ8pSksDEPNqcNzHhCxjCBNtrwgrdTi3wLu1KWiL27

Donate Polkadot to this address

Scan the QR code or copy the address below into your wallet to send some Polkadot

Tag/Note:- DOT Network. Send only DOT to this deposit address. Ensure the network is DOT.
Scan to Donate Binance coin to 0xd9102c12bb34df9b59425dec6b81c3007f8266dd

Donate Binance coin to this address

Scan the QR code or copy the address below into your wallet to send some Binance coin

Tag/Note:- BEP20 (BSC) Binance Smart Chain Network. Send BNB only.
Scan to Donate Litecoin to 0xd9102c12bb34df9b59425dec6b81c3007f8266dd

Donate Litecoin to this address

Scan the QR code or copy the address below into your wallet to send some Litecoin

Tag/Note:- BEP20 (BSC) Binance Smart Chain Network
Scan to Donate Dogecoin to DP4B5yPTJWrGekrneoe4KaXN1XeHpqWKzs

Donate Dogecoin to this address

Scan the QR code or copy the address below into your wallet to send some Dogecoin

Tag/Note:- dogecoin network. Send only DOGE to this deposit address. Ensure the network is dogecoin.
Scan to Donate Tron to TXAyU5qeuiHoDYBFXSkisrfKRBWaVDN3u6

Donate Tron to this address

Scan the QR code or copy the address below into your wallet to send some Tron

Tag/Note:- TRC20 Tron (TRX) Address. Send only TRX to this deposit address. Ensure the network is TRC20.
Scan to Donate Vechain to 0xd9102c12bb34df9b59425dec6b81c3007f8266dd

Donate Vechain to this address

Scan the QR code or copy the address below into your wallet to send some Vechain

Tag/Note:- VeChain Address. Please note that VEN has been swapped to VET. Please avoid sending VEN to your VET address, as your funds will be forever lost. Send only VET to this deposit address. Ensure the network is VeChain.

Similar Posts

Leave a Reply

Your email address will not be published.

This site uses Akismet to reduce spam. Learn how your comment data is processed.